multiplex-quant command
The multiplex-quant command runs the end-to-end simpleaf pipeline for 10x Flex Gene Expression data and related multi-barcode assays. Unlike quant command, which is designed around standard single-cell RNA-seq chemistries and a single cell-barcode whitelist, multiplex-quant handles the extra resources and steps required for Flex assays:
- Flex chemistry lookup from the chemistry registry
- probe set selection by organism
- probe-set CSV to FASTA conversion and
probe_t2g.tsvgeneration - probe index construction with
piscem buildwhen needed - cell barcode whitelist resolution
- sample barcode list resolution
piscem map-scrna- multi-barcode permit-list generation with
alevin-fry generate-permit-list alevin-fry collateandalevin-fry quant
multiplex-quant typically runs against a registered Flex chemistry such as 10x-flexv1-gex-3p or 10x-flexv2-gex-3p, in which case the geometry, cell BC whitelist, sample BC list, and orientations are auto-resolved from the preset. 10x Flex Configuration B is registered as 10x-flexv2-gex-3p-config-b; it shares the v2 whitelists and probe sets but has its own geometry and reads the sample barcode off the opposite strand, so it is selected by name rather than by overriding the v2 preset. For chemistries not in the registry, the preset can be replaced with manual overrides — at minimum --geometry and --cell-bc-list, with optional --probe-set, --sample-bc-list, --expected-ori, and --sample-bc-ori as needed. piscem and alevin-fry must be configured with set paths.
Overview
Section titled “Overview”The command needs:
- paired-end reads via
--reads1and--reads2 - an output directory via
--output - either a registered chemistry name via
--chemistry, or a manual--geometrystring plus--cell-bc-listfor chemistries not in the registry - an organism via
--organismwhen using automatic probe-set selection (i.e. when--probe-setis not provided)
If the chemistry registry contains the needed metadata, simpleaf can automatically download and cache the probe set, the cell barcode whitelist, and the sample barcode list. If you already have local resources, you can override these defaults with --index, --probe-set, --cell-bc-list, or --sample-bc-list.
The default output is the standard Matrix Market directory under af_quant/alevin. If you pass --anndata-out, simpleaf will additionally write an AnnData .h5ad file at af_quant/alevin/quants.h5ad.
Barcode-correction controls
Section titled “Barcode-correction controls”Correction decisions are made during alevin-fry generate-permit-list and
reused by collation through its compiled correction plan. simpleaf exposes the
same typed controls without duplicating alevin-fry’s protocol defaults:
| Option | Inherited default | Destination |
|---|---|---|
--cell-bc-correction {unique,frequency} | unique | permit-list generation |
--cell-bc-neighborhood {hamming-1,substitution-or-shift-1} | protocol/filter-specific | permit-list generation |
--cell-bc-confidence <CONFIDENCE> | 0.975 | permit-list generation |
--sample-bc-correction {exact,unique,frequency} | exact | permit-list generation |
--sample-bc-neighborhood {hamming-1,substitution-or-shift-1} | hamming-1 for non-exact correction | permit-list generation |
--sample-bc-confidence <CONFIDENCE> | 0.975 | permit-list generation |
--gpl-memory-limit <SIZE> | 512 MiB | deferred sample-Frequency buffers |
--gpl-tmp-dir <DIR> | permit-list output directory | compressed deferred runs |
--collate-memory-limit <SIZE> | 2 GiB | collation buffers |
Confidence accepts decimals or exact fractions such as 39/40. Memory accepts
human-readable values such as 512MiB, 1GiB, and 4GB. Values are validated
before mapping begins but forwarded in their original spelling. If an override
is omitted, simpleaf emits no corresponding child flag and alevin-fry remains
the source of truth for the default.
The old hidden --sample-correction-mode option remains accepted for script
compatibility. exact becomes --sample-bc-correction exact; 1-edit becomes
--sample-bc-correction unique --sample-bc-neighborhood substitution-or-shift-1. New scripts should use the explicit controls above.
For multiplex output, the resulting AnnData object is intended to preserve the extra sample-level structure of the experiment:
obs_namesare sample-qualified cell identifiersobs["cell_barcode"]stores the corrected cell barcode without the sample prefixobs["sample_name"]stores the sample / probe-barcode assignmentvar["gene_id"]remains the matrix feature identifiervar["gene_symbol"]is added when agene_id_to_name.tsvmapping is available from the probe set or indexunsstores the standardgpl_info,collate_info,quant_info, andsimpleaf_map_inforecords, and for multiplex runs it also storessample_infoplussimpleaf_multiplex_quant_info
The relevant options (which you can obtain by running simpleaf multiplex-quant --help) are below:
quantify a multiplexed sample (e.g. 10x Flex, or any custom multi-barcode protocol)
Usage: simpleaf multiplex-quant [OPTIONS] --output <OUTPUT>
Options: -c, --chemistry <CHEMISTRY> Chemistry name (e.g. 10x-flexv1-gex-3p). Provides defaults for geometry, cell BC whitelist, sample BC list, and probe set. All can be overridden individually. If omitted, --geometry and --cell-bc-list are required
-g, --geometry <GEOMETRY> Override the read geometry string (e.g. '1{b[16]u[12]x[0-3]hamming(f[TTGCTAGGACCG],1)s[10]x:}2{r:}')
--organism <ORGANISM> Target organism for automatic probe set selection
[possible values: human, mouse]
--cell-bc-list <CELL_BC_LIST> Path to cell barcode whitelist (one barcode per line, overrides chemistry default)
--expected-ori <EXPECTED_ORI> Expected read orientation: fw, rc, or both
[default: both]
--sample-bc-ori <SAMPLE_BC_ORI> Sample barcode orientation: `forward` (whitelist matches read as-is) or `reverse` (reverse-complement the whitelist before lookup). Overrides the chemistry preset's `sample_bc_ori` when set. Useful for cycle-plan variants (e.g. 10x Flex Configuration B) where the sample BC is read off the opposite strand from the canonical preset. Vocabulary matches the preset JSON and alevin-fry's `--sample-bc-ori`
[possible values: forward, reverse]
-o, --output <OUTPUT> Path to output directory
-t, --threads <THREADS> Number of threads to use
[default: 16]
-h, --help Print help (see a summary with '-h')
-V, --version Print version
Advanced Barcode Correction Options: --cell-bc-correction <CELL_BC_CORRECTION> Cell-barcode collision policy (inherited default: unique)
[possible values: unique, frequency]
--cell-bc-neighborhood <CELL_BC_NEIGHBORHOOD> One-error cell-barcode neighbourhood. When omitted, alevin-fry chooses the protocol/filter-specific default
[possible values: hamming-1, substitution-or-shift-1]
--cell-bc-confidence <CONFIDENCE> Frequency confidence as a decimal or exact fraction. The inherited default is 97.5% for RNA and 90% for ATAC
--sample-bc-correction <SAMPLE_BC_CORRECTION> Sample-barcode correction policy (inherited default: exact)
[possible values: exact, unique, frequency]
--sample-bc-neighborhood <SAMPLE_BC_NEIGHBORHOOD> Sample-barcode neighbourhood for non-exact correction (inherited default: Hamming-1)
[possible values: hamming-1, substitution-or-shift-1]
--sample-bc-confidence <CONFIDENCE> Sample-Frequency confidence as a decimal or exact fraction (inherited default: 97.5%)
Advanced Resource Options: --gpl-memory-limit <SIZE> Deferred GPL buffer budget (inherited default: 512 MiB)
--gpl-tmp-dir <DIR> Temporary directory for compressed GPL correction runs (inherited default: the GPL output directory)
--collate-memory-limit <SIZE> Collation buffer budget (inherited default: 2 GiB)
Permit List Options:
--min-reads <MIN_READS> Minimum read count threshold for unfiltered permit list
[default: 10]
Mapping Options: -i, --index <INDEX> Path to pre-built probe index (overrides auto-build)
-1, --reads1 <READS1> Comma-separated list of R1 FASTQ files
-2, --reads2 <READS2> Comma-separated list of R2 FASTQ files
Probe Set Options: --probe-set <PROBE_SET> Path to probe set CSV or FASTA (overrides auto-download). If a CSV is provided, it is converted to FASTA and a t2g map is generated automatically
--kmer-length <KMER_LENGTH> k-mer length for probe index building
[default: 23]
Reference Options: -m, --t2g-map <T2G_MAP> Path to a transcript-to-gene map file. Use this instead of --probe-set when working with a transcriptome reference rather than a probe set
--usa Resolve expression separately into spliced and unspliced counts (USA mode). Requires splicing-aware probe annotations: either a probe CSV with a `region` column (`spliced` / `unspliced`) or a pre-built index with an adjacent 3-column t2g file. By default, expression is grouped at the gene level
--sample-bc-list <SAMPLE_BC_LIST> Path to sample/probe barcode file with rotation mapping (overrides auto-download). 3-column TSV: observed, canonical, sample_name
Quantification Options: -r, --resolution <RESOLUTION> UMI resolution mode
[default: cr-like] [possible values: cr-like, cr-like-em, parsimony, parsimony-em, parsimony-gene, parsimony-gene-em]
--small-thresh <N> Cells with fewer than this many reads are resolved by alevin-fry's tiny-cell fast path, which applies `cr-like` (winner-take-all) semantics regardless of `--resolution`. Pass 0 to resolve every cell with the requested strategy.
Left unset, alevin-fry's own default applies
Piscem Mapping Options: --skipping-strategy <SKIPPING_STRATEGY> The skipping strategy to use for k-mer collection
[default: permissive] [possible values: permissive, strict]
--struct-constraints Enable structural constraints when mapping
--max-ec-card <MAX_EC_CARD> Maximum cardinality equivalence class to examine
[default: 4096]
--dict <DICT> Piscem dictionary backend: `auto` (default), `sshash`, or `tiny`. Applies both to the auto-built probe index (build time) and to map-sc (map time)
[default: auto] [possible values: auto, sshash, tiny]
--decoder <MODE> Gzip decoder selection passed to piscem: `auto`, `serial`, `parallel`, or `parallel=N`.
`auto` lets piscem adapt the mapping/decode split while the run proceeds. `serial` gives mapping the whole budget. `parallel` forces the parallel decoder where the input allows it; `parallel=N` fixes N decode slots per gzip input and stops the adaptation. Inputs that cannot be read positionally (FIFOs, process substitution) stay serial regardless.
[default: auto]
--thread-policy <FILE> JSON file overriding piscem's thread and decoder policy.
Every field is optional and defaults to a measured value; an unrecognised field is an error rather than a silent no-op. Currently understood: `{"parallel_decode": {"min_threads_per_stream": 8}}`, the number of threads that must be free per gzip input before the parallel decoder is engaged at all.
Output Options: --anndata-out Generate an anndata (h5ad format) count matrix from the standard (matrix-market format) outputChemistry preset structure
Section titled “Chemistry preset structure”A registered chemistry name (e.g. 10x-flexv1-gex-3p) selects a JSON entry in simpleaf’s chemistry registry (chemistries.json) that bundles every protocol-level parameter the pipeline needs. Each behavioral field has a corresponding CLI override; only a small set of internal metadata fields are not user-controllable.
Fields stored in a chemistry preset:
geometry— piscem geometry string describing R1/R2 layout (cell BC, UMI, sample BC, biological-read offsets). CLI override:--geometry.expected_ori— orientation of the biological read relative to the reference (fw/rc/both). CLI override:--expected-ori.plist_nameandremote_url— cached filename and download URL for the cell barcode whitelist. CLI override:--cell-bc-list(pass a local path; the URL itself is an internal detail).sample_bc_list(Flex only) — a nested record withplist_name,remote_url, andsample_bc_ori. CLI overrides:--sample-bc-listfor the 3-column TSV path, and--sample-bc-ori(forward/reverse) for the orientation.probe_sets(Flex only) — an organism-keyed dictionary, e.g.{ "human": {...}, "mouse": {...} }. Each entry stores a probe-CSV download URL plus probe-set metadata. CLI overrides:--organismselects which entry is consulted, and--probe-setbypasses the lookup entirely by supplying a local CSV/FASTA.versionandmeta— internal preset versioning and free-form metadata. Not exposed at the CLI; they do not affect pipeline behavior.
How --chemistry and --organism together locate a Flex configuration:
--chemistryresolves to a registered preset entry. That single lookup fixes the protocol parameters for the run:geometry,expected_ori, the cell barcode whitelist, the sample barcode list, and the sample barcode orientation. Any of these can be replaced individually with the corresponding CLI override flag listed above.- For Flex presets the preset’s
probe_setsdict is keyed by organism.--organism(human,mouse, …) selects which entry’s probe CSV will be auto-downloaded.--probe-setsupersedes the lookup, so when--probe-setis given--organismbecomes optional. --chemistryitself can also be omitted. In that case you must supply--geometryand--cell-bc-listat the CLI (and, for sample-multiplexed runs,--sample-bc-list,--sample-bc-ori, and--probe-setas well), since there is no preset to draw defaults from.
For non-Flex chemistries (presets without a probe_sets map), --organism is recorded in run metadata but is otherwise ignored.
Running without --chemistry
Section titled “Running without --chemistry”--chemistry can be omitted entirely when the protocol you want to run is not in the registry, or when you want full manual control over every resource. With no preset to draw defaults from, the pipeline requires you to supply every resource it would otherwise auto-resolve. simpleaf bails with an explicit error if any required input is missing.
Required CLI flags when --chemistry is omitted:
--geometry— the piscem geometry string. Error:No geometry specified. Provide --geometry or --chemistry.--cell-bc-list— local path to the cell barcode whitelist (one barcode per line). Error:No cell barcode whitelist specified. Provide --cell-bc-list or --chemistry.--sample-bc-list— local path to the 3-column sample BC TSV (observed<TAB>canonical<TAB>sample_name). Error:Chemistry has no sample barcode list URL. Provide --sample-bc-list.--probe-setor--index— either a local probe-set CSV/FASTA or a pre-built piscem probe index. Without a preset, simpleaf cannot auto-download a probe set from aprobe_setsdict. Error:No chemistry specified and no --probe-set or --index provided.
Optional CLI flags (defaults apply if unset):
--expected-ori— defaults toboth.--sample-bc-ori— when unset, no--sample-bc-oriis forwarded to alevin-fry, so its own default (forward) takes effect.--resolution— defaults tocr-like.--organism— irrelevant when--probe-setor--indexis supplied (the preset’sprobe_setslookup is skipped).
Example: run a chemistry that is not yet in the registry (e.g. a 10x Flex v2 Configuration B variant) by supplying all resources manually:
$ simpleaf multiplex-quant \ --geometry '1{b[16]u[12]x:}2{r[50]f[CCCATATAAGAAAACCTGAATACGCGGTT]s[10]x:}' \ --expected-ori fw \ --sample-bc-ori forward \ --cell-bc-list /path/to/cell_bc_whitelist.txt \ --sample-bc-list /path/to/sample_bc_rotation.tsv \ --probe-set /path/to/probe_set.csv \ --reads1 sample_R1.fastq.gz \ --reads2 sample_R2.fastq.gz \ --output flex_outIf your protocol becomes stable and reusable, consider proposing it as a chemistry preset upstream so future users can run it with just --chemistry.
Resource resolution
Section titled “Resource resolution”multiplex-quant resolves resources in the following order:
- Probe index:
If
--indexis provided,simpleafaccepts either asimpleaf indexoutput directory, itsindex/subdirectory, thepiscem_idxprefix within that directory, or a multiplex probe-index directory/prefix. It will reuse adjacent metadata and t2g files when present. - Probe set:
If
--probe-setis provided, it overrides the registry entry. A CSV probe set is converted into a FASTA plus a gene-levelprobe_t2g.tsvautomatically, and if proberegionannotations are present it also produces a USA-mode t2g for--usa. A FASTA input is accepted as-is, andsimpleafgenerates an identity-style t2g mapping from the FASTA headers. - Automatic probe-set selection:
If neither
--indexnor--probe-setis provided,simpleaflooks up the requested--organismin the selected chemistry’s registered probe sets, downloads the matching probe CSV if needed, and builds a cached probe index. - Cell barcode whitelist: This is resolved from the selected chemistry’s permit-list metadata in the registry.
- Sample barcode list:
This is resolved from
--sample-bc-listif provided, otherwise from the selected chemistry’s registry metadata. - Sample barcode orientation:
By default,
simpleafforwards the chemistry preset’s declaredsample_bc_ori(when present) toalevin-fry. Pass--sample-bc-ori {forward,reverse}to override the preset value at the CLI level. This is useful for cycle-plan variants where the sample BC is read from the opposite strand vs the canonical preset — for example, 10x Flex Configuration B (R1=28 / R2=90) uses--sample-bc-ori forwardwhereas the default 10x Flex v2 Configuration A preset declaresreverse. The CLI value is forwarded verbatim toalevin-fry --sample-bc-ori; if nothing is set on the CLI and the preset is silent,alevin-frydefaults toforward.
USA-mode requirements
Section titled “USA-mode requirements”--usa is optional. If it is not provided, multiplex-quant collapses probe expression to the gene level even when splicing annotations are available.
If --usa is provided, the reference must carry splicing-aware annotations:
- For probe CSV input, the CSV must contain a
regioncolumn and each included probe must have valuesplicedorunspliced. - For pre-built indices,
simpleafmust be able to find an adjacent 3-column t2g such ast2g_3col.tsvorprobe_t2g_usa.tsv. - FASTA probe sets do not encode splicing status, so they are not compatible with
--usaunless you also provide an explicit splicing-aware--t2g-map.
If the required splicing annotations are not available, simpleaf will stop with an error that explains which input is missing the needed information and suggests rerunning without --usa.
Examples
Section titled “Examples”Use a registry-backed Flex chemistry with automatic resource resolution:
$ export ALEVIN_FRY_HOME=/path/to/af_home$ simpleaf multiplex-quant \ --chemistry 10x-flexv2-gex-3p \ --organism human \ --reads1 sample_R1.fastq.gz \ --reads2 sample_R2.fastq.gz \ --output flex_outUse local probe-set and sample-barcode files instead of downloading them:
$ simpleaf multiplex-quant \ --chemistry 10x-flexv1-gex-3p \ --organism mouse \ --probe-set /path/to/probe_set.csv \ --sample-bc-list /path/to/sample_bc.tsv \ --reads1 lane1_R1.fastq.gz,lane2_R1.fastq.gz \ --reads2 lane1_R2.fastq.gz,lane2_R2.fastq.gz \ --output flex_outUse a pre-built probe index:
$ simpleaf multiplex-quant \ --chemistry 10x-flexv2-gex-3p \ --organism human \ --index /path/to/simpleaf_index_output \ --reads1 sample_R1.fastq.gz \ --reads2 sample_R2.fastq.gz \ --output flex_outRequest AnnData output in addition to the Matrix Market output:
$ simpleaf multiplex-quant \ --chemistry 10x-flexv1-gex-3p \ --organism human \ --reads1 sample_R1.fastq.gz \ --reads2 sample_R2.fastq.gz \ --output flex_out \ --anndata-outRequest USA-mode probe quantification:
$ simpleaf multiplex-quant \ --chemistry 10x-flexv2-gex-3p \ --organism human \ --probe-set /path/to/probe_set.csv \ --usa \ --reads1 sample_R1.fastq.gz \ --reads2 sample_R2.fastq.gz \ --output flex_outOverride the sample barcode orientation for a cycle-plan variant (e.g. 10x Flex v2 Configuration B, R1=28 / R2=90):
$ simpleaf multiplex-quant \ --chemistry 10x-flexv2-gex-3p \ --organism human \ --geometry '1{b[16]u[12]x:}2{r[50]f[CCCATATAAGAAAACCTGAATACGCGGTT]s[10]x:}' \ --sample-bc-ori forward \ --reads1 sample_R1.fastq.gz \ --reads2 sample_R2.fastq.gz \ --output flex_outOutput
Section titled “Output”The command creates the requested output directory and writes:
af_map/: thepiscemmapping outputaf_quant/: thealevin-frypermit-list, collate, and quantification outputaf_quant/simpleaf_map_info.json: parsed mapping metadata copied into the quantification directory for downstream consumers such as AnnData conversionaf_quant/simpleaf_multiplex_quant_info.json: multiplex pipeline metadata copied into the quantification directory so it can be embedded into AnnDataunsaf_quant/gene_id_to_name.tsv: optional gene ID to gene symbol/name mapping copied when available from the probe set or indexaf_quant/alevin/quants.h5ad: optional AnnData output written when--anndata-outis requestedsimpleaf_multiplex_quant_info.json: a metadata record describing the resolved inputs, executed commands, and step timings
multiplex-quantis specific to registered Flex GEX chemistries and related multi-barcode protocols. For standard scRNA-seq chemistries and general custom geometries, use quant command.- The Flex pipeline currently uses
piscemfor mapping. - By default, probe expression is grouped at the gene level. Pass
--usaonly when the input probe set or pre-built index carries explicit splicing annotations.